Quick step by step BLAST guide

 I have got unknown DNA or Protein seq. Its just combination of letters and I want to know what is it actually? What should I do?

Yes, you are correct, the first thing you can do is BLAST and see weather seq. you have aligned with some other seq in the Database.
BLAST does not tell what the seq is if is not in database :)

Let's do BLAST of some seq step by step :

Step 1: Choose any seq or getting ready for BLAST:

Have your seq in note pad or any where from where you can copy directly 

Lets any random seq e.g. I have choosen following seq.

>Unknown seq

ATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAG
TTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGG
GGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGT
GCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACT
GTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCA
TCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAAT
GCCCTGGCCCACAAGTATCACTAA

Step 2: Go the webpage : 

https://blast.ncbi.nlm.nih.gov/Blast.cgi click on this link it will take to the following page

Depending upon what is your seq choose Nucleotide or Protein seq. For now we have chosen the Nucleotide seq so we will choose Nucleotide seq (shown with green arrow) Now new window will open

 

Step 2: Paste your seq and set parameters : : 

Paste your seq in mentioned box, If you have no idea of seq just let the all parameter as default. you can choose parameters if needed.

Now click on BLAST button and... Keep Calm and just wait :),

And we are there Let's check what we have got :)

let's read and understand results

1. query is our seq. which is in green 

2. red lines are the matching seq from database we have hits means our seq is already there in database and now we know what it is 

3. Go below the description first 3 hits are 100 % matching so its our seq basically that is TPA: Homo sapiens GLNA1 gene for globin A1

Congrats!!!!  you just completed BLAST  :)